Top » Catalog » SNPs » Z2105

$18.00

Z2105
[Z2105]

Z2105
hg38 Position: ChrY:13635552..13635552
Ancestral: C
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2105_F GCCCTGTAACTGCGAATACC
Reverse Primer: Z2105_R GTTGCCAAGGTAGCTCCAAC
Reviews

Customers who bought this product also purchased
A11720
A11720
R1b-Z2103 Panel
R1b-Z2103 Panel
Y101118
Y101118
P312
P312
Y36979
Y36979
Y140934
Y140934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies