Top » Catalog » SNPs » Z2105

$18.00

Z2105
[Z2105]

Z2105
hg38 Position: ChrY:13635552..13635552
Ancestral: C
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2105_F GCCCTGTAACTGCGAATACC
Reverse Primer: Z2105_R GTTGCCAAGGTAGCTCCAAC
Reviews

Customers who bought this product also purchased
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Z29764
Z29764
M343
M343
PF7562
PF7562
BY16680
BY16680
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies