Top » Catalog » SNPs » Z2105

$18.00

Z2105
[Z2105]

Z2105
hg38 Position: ChrY:13635552..13635552
Ancestral: C
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2
Comments: downstream of L150; parallel to L51
Forward Primer: Z2105_F GCCCTGTAACTGCGAATACC
Reverse Primer: Z2105_R GTTGCCAAGGTAGCTCCAAC
Reviews

Customers who bought this product also purchased
Y36979
Y36979
Y140934
Y140934
U152
U152
PF7563
PF7563
Y83965
Y83965
U106
U106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies