Top » Catalog » SNPs » Z2109

$19.00

Z2109
[Z2109]

Z2109
hg38 Position: ChrY:11970733..11970733
Ancestral: T
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c1
Comments: downstream of L150; parallel to L51
Forward Primer: Z2109_F GACCGACAGAGAACATCCAG
Reverse Primer: Z2109_R GTGGTGGAATTTGTGAGGGT
Reviews (2)

Customers who bought this product also purchased
FGC41543
FGC41543
Y305501
Y305501
FT67901
FT67901
Y29918
Y29918
PF6285
PF6285
A12703
A12703
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies