Top » Catalog » SNPs » Z2109

$18.00

Z2109
[Z2109]

Z2109
hg38 Position: ChrY:11970733..11970733
Ancestral: T
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c1
Comments: downstream of L150; parallel to L51
Forward Primer: Z2109_F GACCGACAGAGAACATCCAG
Reverse Primer: Z2109_R GTGGTGGAATTTGTGAGGGT
Reviews (2)

Customers who bought this product also purchased
Y36979
Y36979
Y140934
Y140934
L21
L21
PF7563
PF7563
Y83965
Y83965
PF7562
PF7562
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies