Top » Catalog » SNPs » Z251

$18.00

Z251
[Z251]

Z251
hg38 Position: ChrY:8868293..8868293
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1j
Comments: approx. downstream of R-DF13
Forward Primer: Z251_F GATAACGGGCCATCATTTCTGA
Reverse Primer: Z251_R TGGTGGGAGACGTCAGGAT
Reviews

Customers who bought this product also purchased
BY20463
BY20463
R1b-DF27 Panel
R1b-DF27 Panel
Y18437
Y18437
Y18513
Y18513
BY3927
BY3927
A7907
A7907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies