Top » Catalog » SNPs » Z251

$18.00

Z251
[Z251]

Z251
hg38 Position: ChrY:8868293..8868293
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1j
Comments: approx. downstream of R-DF13
Forward Primer: Z251_F GATAACGGGCCATCATTTCTGA
Reverse Primer: Z251_R TGGTGGGAGACGTCAGGAT
Reviews

Customers who bought this product also purchased
FGC17897
FGC17897
FGC17898
FGC17898
FGC19454
FGC19454
L526
L526
A2121
A2121
A194
A194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies