Top » Catalog » SNPs » FGC84152

$18.00

FGC84152
[FGC84152]

FGC84152
hg38 Position: ChrY:11477084..11477084
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC84152_F CGATATTAGATTCTCTCTCTTGAAGTCTAC
Reverse Primer: FGC84152_R GCACACCAACATGGCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies