Top » Catalog » SNPs » A262

$18.00

A262
[A262]

A262
hg38 Position: ChrY:9553447..9553447
Ancestral: G
Derived: T
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream L338+ AS1H
Forward Primer: A262_F TCTTTGAACATCGATCACTCTCTG
Reverse Primer: A262_R GCTTTGGAGACCACAGGAATC
Reviews

Customers who bought this product also purchased
I1-L338 Hamilton Group Panel
I1-L338 Hamilton Group Panel
S2000
S2000
A681
A681
A376
A376
A264
A264
A261
A261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies