Top » Catalog » SNPs » MC14

$18.00

MC14
[MC14]

MC14
HG19 Position: ChrY:21724919..21724919
Ancestral: A
Derived: G
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Downstream from R1b-DF13
Forward Primer: MC14_F GCCTGGTCTCTGATCTGGTC
Reverse Primer: MC14_R TTTGCTGGGTGAAGGAGAAG
Reviews (1)

Customers who bought this product also purchased
Y9097
Y9097
A6368
A6368
A1298
A1298
A7609
A7609
FGC7448
FGC7448
A897
A897
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x MC14
$18.00
Haplogroup Info
Other products
Currencies