Top » Catalog » SNPs » MC14

$18.00

MC14
[MC14]

MC14
hg38 Position: ChrY:19563033..19563033
Ancestral: A
Derived: G
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Downstream from R1b-DF13
Forward Primer: MC14_F GCCTGGTCTCTGATCTGGTC
Reverse Primer: MC14_R TTTGCTGGGTGAAGGAGAAG
Reviews (1)

Customers who bought this product also purchased
A7254
A7254
A7757
A7757
Y9097
Y9097
A6368
A6368
A1298
A1298
A7609
A7609
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies