Top » Catalog » SNPs » Y6211

$18.00

Y6211
[Y6211]

Y6211
hg38 Position: ChrY:22273719..22273719
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I1a1b1
Comments: Downstream of P109 > S7660> S14887 > FGC14514
Forward Primer: Y6211_F GAAATAATAAACCGAGGGACTGAC
Reverse Primer: Y6211_R TCTATTCAGTAACATTTTAATGCCTGTAC
Reviews

Customers who bought this product also purchased
Y6210
Y6210
I1-Y3663 Bottleneck at FGC14500 Panel.
I1-Y3663 Bottleneck at FGC14500 Panel.
Y6209
Y6209
Y6208
Y6208
FGC14501
FGC14501
Y6207
Y6207
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies