Top » Catalog » SNPs » Y6211

$18.00

Y6211
[Y6211]

Y6211
hg38 Position: ChrY:22273719..22273719
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I1a1b1
Comments: Downstream of P109 > S7660> S14887 > FGC14514
Forward Primer: Y6211_F GAAATAATAAACCGAGGGACTGAC
Reverse Primer: Y6211_R TCTATTCAGTAACATTTTAATGCCTGTAC
Reviews

Customers who bought this product also purchased
Y6208
Y6208
FGC14501
FGC14501
Y6207
Y6207
Y7092
Y7092
Y6206
Y6206
Y6212
Y6212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies