Top » Catalog » SNPs » CTS11248

$18.00

CTS11248
[CTS11248]

CTS11248
hg38 Position: ChrY:20871353..20871353
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1a
Comments: Equivalent to M132
Forward Primer: CTS11248_F TTATTTAAAGAGTCAACAACTCATGAGTC
Reverse Primer: CTS11248_R ATCAAATCAGTGGGAAACCATTAG
Reviews

Customers who bought this product also purchased
M145
M145
V38
V38
Y77409
Y77409
M526
M526
CTS8432
CTS8432
V1994
V1994
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies