Top » Catalog » SNPs » CTS11248

$18.00

CTS11248
[CTS11248]

CTS11248
hg38 Position: ChrY:20871353..20871353
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1a
Comments: Equivalent to M132
Forward Primer: CTS11248_F TTATTTAAAGAGTCAACAACTCATGAGTC
Reverse Primer: CTS11248_R ATCAAATCAGTGGGAAACCATTAG
Reviews

Customers who bought this product also purchased
M172
M172
M75
M75
Y28840
Y28840
M267
M267
V13
V13
V1061
V1061
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies