Top » Catalog » SNPs » CTS11248

$18.00

CTS11248
[CTS11248]

CTS11248
hg38 Position: ChrY:20871353..20871353
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1a
Comments: Equivalent to M132
Forward Primer: CTS11248_F TTATTTAAAGAGTCAACAACTCATGAGTC
Reverse Primer: CTS11248_R ATCAAATCAGTGGGAAACCATTAG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
V22
V22
L608
L608
M145
M145
V38
V38
Y77409
Y77409
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies