Top » Catalog » SNPs » Y2608

$18.00

Y2608
[Y2608]

Y2608
hg38 Position: ChrY:13020370..13020370
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b1a (not listed)
Comments: Aka FGC15010; found from public sources
Forward Primer: Y2608_F CCACTTTAGCCATGCTGGTC
Reverse Primer: Y2608_R TGCCAGGGTAACTGGCTG
Reviews

Customers who bought this product also purchased
Y2194
Y2194
BY27373
BY27373
Z93
Z93
YP1506
YP1506
Y41337
Y41337
YP5585
YP5585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies