Top » Catalog » SNPs » Y2609

$18.00

Y2609
[Y2609]

Y2609
hg38 Position: ChrY:13425761..13425761
Ancestral: C
Derived: T
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b1a (not listed)
Comments: Found from public sources
Forward Primer: Y2609_F CTTTCCCTCGTCTGGAAATG
Reverse Primer: Y2609_R ATTGCTGGAGCATTGTTGG
Reviews

Customers who bought this product also purchased
Y2395
Y2395
R1a-Z93 Panel
R1a-Z93 Panel
M458
M458
Y41337
Y41337
Z93
Z93
YP4999
YP4999
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies