Top » Catalog » SNPs » Y2609

$18.00

Y2609
[Y2609]

Y2609
hg38 Position: ChrY:13425761..13425761
Ancestral: C
Derived: T
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b1a (not listed)
Comments: Found from public sources
Forward Primer: Y2609_F CTTTCCCTCGTCTGGAAATG
Reverse Primer: Y2609_R ATTGCTGGAGCATTGTTGG
Reviews

Customers who bought this product also purchased
Z93
Z93
YP4999
YP4999
YP1506
YP1506
Z282
Z282
YP5585
YP5585
Z91
Z91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies