Top » Catalog » SNPs » FGC3216

$18.00

FGC3216
[FGC3216]

FGC3216
hg38 Position: ChrY:12319197..12319198
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: FGC3216_F AATAATCAGCTGCATGCATGTC
Reverse Primer: FGC3216_R CTCCTTGTCTATCAACTCATAATGC
Reviews

Customers who bought this product also purchased
Z39298
Z39298
Z18000
Z18000
Z29546
Z29546
S190
S190
Z17994
Z17994
R1b-DF21 Panel
R1b-DF21 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies