Top » Catalog » SNPs » FGC3216

$18.00

FGC3216
[FGC3216]

FGC3216
hg38 Position: ChrY:12319197..12319198
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: FGC3216_F AATAATCAGCTGCATGCATGTC
Reverse Primer: FGC3216_R CTCCTTGTCTATCAACTCATAATGC
Reviews

Customers who bought this product also purchased
S425
S425
Z36747
Z36747
Z39298
Z39298
Z18000
Z18000
Z29546
Z29546
S190
S190
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies