Top » Catalog » SNPs » Z6692

$18.00

Z6692
[Z6692]

Z6692
hg38 Position: ChrY:15921405..15921405
Ancestral: T
Derived: A
Reference: Alan Berezov Administrator G-L293 Y-DNA Project.
ISOGG Haplogroup: G2a1a1a1
Comments: Found in a G-L293 person
Forward Primer: Z6692_F CTCTCCTTACCTGGGTTTATTTTC
Reverse Primer: Z6692_R GCGTGAGGAAACCCTGAAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Z6679
Z6679
Z7958
Z7958
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies