Top » Catalog » SNPs » A223

$18.00

A223
[A223]

A223
hg38 Position: ChrY:12106147..12106147
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a4
Comments: R1b-M222/S660
Forward Primer: A223_F TCCTGAGGCATGCGCATC
Reverse Primer: A223_R GGAGTCCTGTACATGTACATGCAC
Reviews

Customers who bought this product also purchased
FGC32899
FGC32899
A22790
A22790
A22792
A22792
A1774
A1774
FT410057
FT410057
BY35731
BY35731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies