Top » Catalog » SNPs » CTS2085

$18.00

CTS2085
[CTS2085]

CTS2085
hg38 Position: ChrY:12055371..12055371
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Extracted from 1000 genomes data. Found in a R1b-FGC5496/S1088 person
Forward Primer: CTS2085_F GGTGATCTGTGAGATTTGGGTAC
Reverse Primer: CTS2085_R GGTGCAATCTTGCCTCACTG
Reviews

Customers who bought this product also purchased
A164
A164
A181
A181
A170
A170
A187
A187
A175
A175
A192
A192
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies