Top » Catalog » SNPs » CTS2085

$18.00

CTS2085
[CTS2085]

CTS2085
hg38 Position: ChrY:12055371..12055371
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Extracted from 1000 genomes data. Found in a R1b-FGC5496/S1088 person
Forward Primer: CTS2085_F GGTGATCTGTGAGATTTGGGTAC
Reverse Primer: CTS2085_R GGTGCAATCTTGCCTCACTG
Reviews

Customers who bought this product also purchased
A165
A165
A183
A183
A171
A171
A188
A188
A176
A176
A193
A193
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies