Top » Catalog » SNPs » CTS2085

$18.00

CTS2085
[CTS2085]

CTS2085
hg38 Position: ChrY:12055371..12055371
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Extracted from 1000 genomes data. Found in a R1b-FGC5496/S1088 person
Forward Primer: CTS2085_F GGTGATCTGTGAGATTTGGGTAC
Reverse Primer: CTS2085_R GGTGCAATCTTGCCTCACTG
Reviews

Customers who bought this product also purchased
A178
A178
A166
A166
A184
A184
A172
A172
A189
A189
A177
A177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies