Top » Catalog » SNPs » S26015

$18.00

S26015
[S26015]

S26015
hg38 Position: ChrY:21835323..21835323
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: S26015_F CACCAGGCCAGTTTGGTC
Reverse Primer: S26015_R GCTTGAGGTTGCTTTAGGCTAG
Reviews

Customers who bought this product also purchased
BY50887
BY50887
BY155589
BY155589
Y161798
Y161798
Y161799
Y161799
Y97307
Y97307
BY4600
BY4600
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies