Top » Catalog » SNPs » S26015

$18.00

S26015
[S26015]

S26015
hg38 Position: ChrY:21835323..21835323
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: S26015_F CACCAGGCCAGTTTGGTC
Reverse Primer: S26015_R GCTTGAGGTTGCTTTAGGCTAG
Reviews

Customers who bought this product also purchased
BY4642
BY4642
FGC71977
FGC71977
Y16729
Y16729
BY4684
BY4684
BY4574
BY4574
BY155589
BY155589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies