Top » Catalog » SNPs » S2979

$18.00

S2979
[S2979]

S2979
hg38 Position: ChrY:19673019..19673019
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: S2979_F TCAAGGACCTGAGACACAGC
Reverse Primer: S2979_R ATCCTGCCAACCCAGAAATC
Reviews

Customers who bought this product also purchased
Y142744
Y142744
Y178742
Y178742
FT91330
FT91330
S25577
S25577
BY5500
BY5500
BY5350
BY5350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies