Top » Catalog » SNPs » S2979

$18.00

S2979
[S2979]

S2979
hg38 Position: ChrY:19673019..19673019
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: S2979_F TCAAGGACCTGAGACACAGC
Reverse Primer: S2979_R ATCCTGCCAACCCAGAAATC
Reviews

Customers who bought this product also purchased
BY5570
BY5570
S19341
S19341
Y142744
Y142744
ZQ825
ZQ825
BY159269
BY159269
BY189808
BY189808
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies