Top » Catalog » SNPs » V12

$18.00

V12
[V12]

V12
hg38 Position: ChrY:6955058..6955058
Ancestral: A
Derived: G
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1a1
Comments: Aka Z1216; TBL1Y region
Forward Primer: V12v2_F CTCTGTGGGAAATTTATTATGCCT
Reverse Primer: V12v2_R TTATGATCCAAGAGGGAGAATAAAG
Reviews

Customers who bought this product also purchased
Z814
Z814
BY8141
BY8141
Y15945
Y15945
Y18174
Y18174
Y28701
Y28701
CTS9823
CTS9823
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies