Top » Catalog » SNPs » V12

$18.00

V12
[V12]

V12
hg38 Position: ChrY:6955058..6955058
Ancestral: A
Derived: G
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1a1
Comments: Aka Z1216; TBL1Y region
Forward Primer: V12v2_F CTCTGTGGGAAATTTATTATGCCT
Reverse Primer: V12v2_R TTATGATCCAAGAGGGAGAATAAAG
Reviews

Customers who bought this product also purchased
Z1231
Z1231
PF2287
PF2287
PF2282
PF2282
Z21238
Z21238
BY5350
BY5350
E1b-V13 Panel
E1b-V13 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies