Top » Catalog » SNPs » CTS5856

$18.00

CTS5856
[CTS5856]

CTS5856
hg38 Position: ChrY:14397645..14397645
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E (not listed)
Comments: Syn. with CTS10912; downstream CTS10323
Forward Primer: CTS5856_F CACTTTTCCGATTGCCTTG
Reverse Primer: CTS5856_R AAGCAAAGGCTGGTACAAAAG
Reviews

Customers who bought this product also purchased
FT77240
FT77240
A10956
A10956
BY6527
BY6527
BY6279
BY6279
BY6338
BY6338
BY153006
BY153006
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies