Top » Catalog » SNPs » FGC13933

$18.00

FGC13933
[FGC13933]

FGC13933
hg38 Position: ChrY:26452627..26452627
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: .
Forward Primer: FGC13933_F ACACTACCTACATTTTGAAAGTTGTAAGAC
Reverse Primer: FGC13933_R ATATTAAAAGAACATTTACAATTGAAATAACG
Reviews

Customers who bought this product also purchased
A230
A230
A255
A255
A243
A243
A248
A248
A229
A229
A254
A254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies