Top » Catalog » SNPs » Z7940

$18.00

Z7940
[Z7940]

Z7940
hg38 Position: ChrY:14484892..14484892
Ancestral: T
Derived: C
Reference: Y DNA community
ISOGG Haplogroup: G2a1a1a1a1a1
Comments: Aka FGC724; Found in a G-L293 person
Forward Primer: Z7940_F GAGCACAGGCTTTATCTGAGC
Reverse Primer: Z7940_R TGATCTCAGGGCCAAATCC
Reviews

Customers who bought this product also purchased
Z7944
Z7944
FGC750
FGC750
Z31460
Z31460
FGC715
FGC715
Z31461
Z31461
G2a-Z6552 Panel
G2a-Z6552 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies