Top » Catalog » SNPs » Z7700

$18.00

Z7700
[Z7700]

Z7700
hg38 Position: ChrY:7002783..7002783
Ancestral: C
Derived: G
Reference: Al Aburto (2014)
ISOGG Haplogroup: J2a1a2c1b3
Comments: downstream of J2a L25. approx. equivalent to F3133
Forward Primer: Z7700_F TTAAGGAACCAGAGAGACCGAG
Reverse Primer: Z7700_R AAAAGAATTTAAGTAGCTCCCGAG
Reviews

Customers who bought this product also purchased
PF5416
PF5416
FGC35362
FGC35362
Z41168
Z41168
Z40776
Z40776
Y24651
Y24651
Z44439
Z44439
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies