Top » Catalog » SNPs » A206

$18.00

A206
[A206]

A206
hg38 Position: ChrY:7309500..7309500
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A206_F TTTGCCACTTGGACACATTG
Reverse Primer: A206_R TGCACAGAAAACACAAAATGC
Reviews

Customers who bought this product also purchased
A211
A211
A348
A348
A217
A217
A354
A354
A340
A340
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A24441
1 x A17065
$36.00
Haplogroup Info
Other products
Currencies