Top » Catalog » SNPs » A208

$18.00

A208
[A208]

A208
hg38 Position: ChrY:12252265..12252265
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person
Forward Primer: A208_F GATTTTGTGCACAGCTCGTC
Reverse Primer: A208_R AACTGAATCAGGGCAGGATG
Reviews

Customers who bought this product also purchased
A218
A218
A352
A352
A338
A338
DYS481
DYS481
A341
A341
A216
A216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies