Top » Catalog » SNPs » A211

$18.00

A211
[A211]

A211
hg38 Position: ChrY:13761797..13761797
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in a R1b-CTS4466 person
Forward Primer: A211v2_F TTTTATTAAAATAGAGACAGGGCTTTG
Reverse Primer: A211v2_R AGGACATTAGCTCATTACTCTGGAC
Reviews

Customers who bought this product also purchased
A337
A337
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A346
A346
A214
A214
A350
A350
A293
A293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies