Top » Catalog » SNPs » BY84499

$18.00

BY84499
[BY84499]

BY84499
hg38 Position: ChrY:11057591..11057591
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY84499_F AACCACAATACTCCTCCCACAG
Reverse Primer: BY84499_R GCCTCTATTGTCTCTGTAATACAGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies