Top » Catalog » SNPs » FT270551

$18.00

FT270551
[FT270551]

FT270551
hg38 Position: ChrY:19083094..19083094
Ancestral: A
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: E1b
Comments: Below L19 > Z5009
Forward Primer: FT270551_F GGAGAGAAATAATGTTACTGCTAGATTG
Reverse Primer: FT270551_R GGTTGCCAAGTTCAATAGGGTATAG
Reviews

Customers who bought this product also purchased
MZ90
MZ90
M81
M81
Y128375
Y128375
BY9700
BY9700
FT76699
FT76699
BY9626
BY9626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies