Top » Catalog » SNPs » FT83707

$18.00

FT83707
[FT83707]

FT83707
hg38 Position: ChrY:13483255..13483255
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FT83707_F ACCTGATATATGTGAATGCATGTAGC
Reverse Primer: FT83707_R CATTGTAGAAGACAGTGTGGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies