Top » Catalog » SNPs » A27614

$18.00

A27614
[A27614]

A27614
hg38 Position: ChrY:14801119..14801119
Ancestral: A
Derived: C
Reference: Bachir (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A27614_F AACACAAAATCCAAATGTCAAGTG
Reverse Primer: A27614_R AACAGGAGGAATAAATTATAATGTATACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies