Top » Catalog » SNPs » A27615

$18.00

A27615
[A27615]

A27615
hg38 Position: ChrY:15579317..15579317
Ancestral: T
Derived: A
Reference: Bachir (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A27615_F ACAACATGCCATCAAGATATTTAAAG
Reverse Primer: A27615_R TGTGAATTATAGTCTTCTTTTCCTCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies