Top » Catalog » SNPs » VK12

$18.00

VK12
[VK12]

VK12
hg38 Position: ChrY:12626836..12626836
Ancestral: T
Derived: C
Reference: Kudryashov (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: VK12_F ACTTGTTTTGGTTGGTAGGCTG
Reverse Primer: VK12_R CGTAACCAATGAGAACAAATATACAATG
Reviews

Customers who bought this product also purchased
VK23
VK23
VK22
VK22
VK21
VK21
VK17
VK17
VK14
VK14
VK13
VK13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies