Top » Catalog » SNPs » Z4624

$18.00

Z4624
[Z4624]

Z4624
hg38 Position: ChrY:16042213..16042213
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: H1a1d2c2
Comments: under M82
Forward Primer: Z4624_F AGTCTTGGAAGGGTGTGTGG
Reverse Primer: Z4624_R ACTCAGTGGGCAGGACAATC
Reviews

Customers who bought this product also purchased
YP5248
YP5248
YP6476
YP6476
YP258
YP258
YP5950
YP5950
A19325
A19325
R1a-M458 Panel
R1a-M458 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies