Top » Catalog » SNPs » Z4624

$18.00

Z4624
[Z4624]

Z4624
hg38 Position: ChrY:16042213..16042213
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: H1a1d2c2
Comments: under M82
Forward Primer: Z4624_F AGTCTTGGAAGGGTGTGTGG
Reverse Primer: Z4624_R ACTCAGTGGGCAGGACAATC
Reviews

Customers who bought this product also purchased
BY30698
BY30698
Y107244
Y107244
YP1337
YP1337
Y132956
Y132956
Y166625
Y166625
L260
L260
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies