Top » Catalog » SNPs » Z4624

$18.00

Z4624
[Z4624]

Z4624
hg38 Position: ChrY:16042213..16042213
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: H1a1d2c2
Comments: Observed under H-M82 and R1a-YP1337
Forward Primer: Z4624_F AGTCTTGGAAGGGTGTGTGG
Reverse Primer: Z4624_R ACTCAGTGGGCAGGACAATC
Reviews

Customers who bought this product also purchased
A19325
A19325
R1a-M458 Panel
R1a-M458 Panel
Y37285
Y37285
YP1341
YP1341
BY30698
BY30698
Y107244
Y107244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies