Top » Catalog » SNPs » Z4624

$18.00

Z4624
[Z4624]

Z4624
hg38 Position: ChrY:16042213..16042213
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: H1a1d2c2
Comments: Observed under H-M82 and R1a-YP1337
Forward Primer: Z4624_F AGTCTTGGAAGGGTGTGTGG
Reverse Primer: Z4624_R ACTCAGTGGGCAGGACAATC
Reviews

Customers who bought this product also purchased
YP254
YP254
YP5248
YP5248
YP6476
YP6476
YP258
YP258
YP5950
YP5950
A19325
A19325
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies