Top » Catalog » SNPs » A216

$18.00

A216
[A216]

A216
hg38 Position: ChrY:19205038..19205038
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A216_F GGCTGGAAGCAGGAGTAGTG
Reverse Primer: A216_R GGGGTGAAATAGGAGGATGG
Reviews

Customers who bought this product also purchased
A293
A293
DYS481
DYS481
A344
A344
A211
A211
A349
A349
A292
A292
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies