Top » Catalog » SNPs » A217

$18.00

A217
[A217]

A217
hg38 Position: ChrY:19428489..19428489
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A217_F TTGTGGCAGAACACAGTTGG
Reverse Primer: A217_R GCCCCAAACCATTTCTTCTC
Reviews

Customers who bought this product also purchased
A218
A218
A354
A354
A340
A340
A208
A208
A347
A347
A216
A216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies