Top » Catalog » SNPs » A217

$18.00

A217
[A217]

A217
hg38 Position: ChrY:19428489..19428489
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1b1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A217_F TTGTGGCAGAACACAGTTGG
Reverse Primer: A217_R GCCCCAAACCATTTCTTCTC
Reviews

Customers who bought this product also purchased
A337
A337
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A346
A346
A212
A212
A350
A350
A293
A293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A763
1 x A1094
1 x A2261
1 x A752
1 x A151
1 x A2262
1 x A541
1 x A386
1 x A161
1 x A455
1 x A968
1 x A45
1 x A254
1 x A2154
1 x A346
$288.00
Haplogroup Info
Other products
Currencies