Top » Catalog » SNPs » PF7395

$18.00

PF7395
[PF7395]

PF7395
hg38 Position: ChrY:12018379..12018379
Ancestral: C
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1b (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7395_F CCATGCAGGCTTAGATGGAC
Reverse Primer: PF7395_R CTCTCCCCATACCCAATTTC
Reviews

Customers who bought this product also purchased
CTS11388
CTS11388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies